Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircSLC8A1-1 | |||
Gene | SLC8A1 | Organism | Human |
Genome Locus | chr3:179113875-179137293:- | Build | hg19 |
Disease | Heart disease | ICD-10 | Cardiovascular disease, unspecified (I51.6) |
DBLink | Link to database | PMID | 28082450 |
Experimental Method | |||
Sample Type | Cardiomyocytes | Comparison | 12 human hearts, 25 mouse hearts and across a 28-day differentiation time-course of human embryonic stem cell-derived cardiomyocytes. |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGTGAGTGAGAGCATTGGCA ReverseATCCCATTGAAAAGGTGGGTGA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Tan, WL, Lim, BT, Anene-Nzelu, CG, Ackers-Johnson, M, Dashi, A, See, K, Tiang, Z, Lee, DP, Chua, WW, Luu, TD, Li, PY, Richards, AM, Foo, RS (2017). A landscape of circular RNA expression in the human heart. Cardiovasc. Res., 113, 3:298-309. |